Antibody Panels and Kits

196 – 210 of 920 results

196

MilliporeSigma™ Upstate™ Sox-2, clone 6F1.2α, 6F1.2, ChIP Validated Antibody and Primer Set

Mouse Monoclonal Antibody

Pricing & Availability
Specifications

Content And Storage	-20°C for one year from date of shipment; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles
Host Species	Mouse
Applications	ChIP Assay,Dot Blot,Immunocytochemistry,Western Blot
Form	Purified
Gene Accession No.	P48431
Isotype	IgG2b κ
Includes	This ChIPAb+ Sox-2, clone 6F1.2 -ChIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.
Antigen	Sox-2, clone 6F1.2α
Regulatory Status	RUO
Gene Symbols	SOX2; ANOP3; MGC2413; MCOPS3
Gene ID (Entrez)	NP_003097
Formulation	Anti-Sox-2, clone 6F1.2 (mouse monoclonal IgG). One vial containing 100μg of protein A purified antibody in 140μL of 0.02M phosphate buffer pH 7.6 with 0.25M NaCl containing 0.1% sodium azide, and 30% glycerol. ChIP Primers, nanog promoter. One vial containing 75μL of 5μM of each primer specific for the promoter region of human nanog. FOR: GTT CTG TTG CTC GGT TTT CT; REV: TCC CGT CTA CCA GTC TCA CC
Immunogen	Recombinant GST Fusion protein.
Classification	Monoclonal
Primary or Secondary	Primary
Clone	6F1.2
Test Specificity	Recognizes Sox-2, MW: ∽34kDa.

197

MilliporeSigma™ Upstate™ EZH2, clone AC22α, Mouse monoclonal, ChIP Validated Antibody and Primer Set

Mouse Monoclonal Antibody

Pricing & Availability
Specifications

Content And Storage	-20°C for one year from date of shipment; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles
Host Species	Mouse
Applications	ChIP Assay,Western Blot
Form	Purified
Gene Accession No.	Q15910
Isotype	IgG2a
Includes	EZH2, clone AC22, ChIP validated Antibody and Primer set including the ChIP-grade antibody and the specific control PCR primers used for chromatin immunoprecipitation of EZH2.
Antigen	EZH2, clone AC22α
Regulatory Status	RUO
Gene Symbols	EZH2; KMT6
Gene ID (Entrez)	NP_004447.2
Formulation	EZH2, clone AC22 (mouse monoclonal IgG2a). One vial containing 50μg of protein G purified antibody in 50μL PBS containing 0.05% sodium azide. Normal Mouse IgG. Two vials, each containing 25μg purified mouse IgG in 25μL storage buffer containing 0.1% sodium azide. ChIP Primers MYT-1 promoter Region. One vial containing 75μL of 5μM of each primer specific for the promoter region of human MYT-1. FOR: ACA AAG GCA GAT ACC CAA CG; REV: GCA GTT TCA AAA AGC CAT CC
Immunogen	EZH2,clone AC22 purified antibody is made against a GST fusion protein corresponding to amino acids 353-451 of human EZH2.
Classification	Monoclonal
Primary or Secondary	Primary
Test Specificity	Recognizes EZH2, MW: ∽85-100kDa.

198

MilliporeSigma™ Upstate ChIPAb+ Dimethyl-Histone H3 (Lys9) - ChIP Validated Antibody and Primer Set

Dimethyl-histone H3 (Lys9) purified antibody is made against synthetic peptide (dimethylated at Lys9) corresponding to amino acids 1-18 of histone H3

Pricing & Availability

199

MilliporeSigma™ Upstate™ PCAF, Rabbbit Polyclonal, ChIP Validated Antibody and Primer Set

Rabbit Polyclonal Antibody

Pricing & Availability
Specifications

Content And Storage	-20°C for up to 12 months from date of receipt; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles
Host Species	Rabbit
Applications	ChIP Assay,Western Blot
Form	Purified
Gene Accession No.	Q92831
Includes	This ChIPAb+ Validated Antibody and Primer Set conveniently includes the antibody, matched IgG negative control antibody and set control PCR primers that detect a known positive locus.
Antigen	PCAF
Regulatory Status	RUO
Gene Symbols	GCN5, GCN5L, P/CAF, P, CAF, PCAF, KAT2B
Gene ID (Entrez)	NP_003875
Formulation	Anti-PCAF (Rabbit Polyclonal). One vial containing 17.5μg purified rabbit polyclonal in 25μL buffer containing Tris-citrate/phosphate buffer (pH 7 to 8) and 0.09% sodium azide, before the addition of 30% glycerol (0.7mg/mL final). Normal Rabbit IgG. One vial containing 125μg of purified Rabbit IgG in 125μL storage buffer containing 0.05% sodium azide. ChIP Primers, PRAME. One vial containing 75μL of 5μM of each primer specific for human preferentially expressed antigen in melanoma (chr22:22901678+22901804, hg19 build). FOR: GAA GCC TCG CCG GAA CTC; REV: TCC TCC CCA TCT CTG CAG AA
Immunogen	Recombinant protein corresponding to human PCAF (a.a. 782-832).
Classification	Polyclonal
Primary or Secondary	Primary
Test Specificity	Recognizes PCAF in regions between a.a. 782 to 832.

200

MilliporeSigma™ Upstate™ CHD1, Rabbbit Polyclonal, ChIP Validated Antibody and Primer Set

Rabbit Polyclonal Antibody

Pricing & Availability
Specifications

Content And Storage	-20°C for up to 12 months from date of receipt; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles
Host Species	Rabbit
Applications	ChIP Assay,Western Blot
Form	Purified
Gene Accession No.	O14646
Includes	This ChIPAb+ Validated Antibody and Primer Set conveniently includes the antibody, matched IgG negative control antibody and set control PCR primers that detect a known positive locus.
Antigen	CHD1
Regulatory Status	RUO
Gene Symbols	Chd1, Chd-1
Gene ID (Entrez)	NP_001261
Formulation	Anti-CHD1 (Rabbit Polyclonal). One vial containing 7.0μg purified rabbit polyclonal in 50μL buffer of Tris-buffered Saline containing 0.1% BSA and 0.09% Sodium Azide, before the addition of 30% glycerol (0.14mg/mL final). Normal Rabbit IgG. One vial containing 125μg of purified Rabbit IgG in 125μL storage buffer containing 0.05% sodium azide. ChIP Primers, PSMC6. One vial containing 75μL of 5μM of each primer specific for human proteasome 26S subunit 6 (chr14:53174161+53174274 , hg19 build). Primer location selection based on ENCODE browser data at UCSC, see also reference 1. FOR: TCC GGC CCT GAG CTT GT; REV: CCT CCT CTA CTT CTT TTT CAT TTT CAC
Immunogen	Recombinant protein corresponding to human CHD1 (a.a. 1660-1710).
Classification	Polyclonal
Primary or Secondary	Primary
Test Specificity	Recognizes CHD1 in regions between a.a. 1660 to 1710.

201

MilliporeSigma™ Upstate™ Acetyl-Histone H4 (Lys12)α, Rabbit Monoclonal, ChIP Validated Antibody and Primer Set

Rabbit Monoclonal Antibody

Pricing & Availability
Specifications

Content And Storage	-20°C for one year from date of shipment; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles
Host Species	Rabbit
Applications	ChIP Assay,Functional Assay,Western Blot
Form	Purified
Gene Accession No.	P62805
Isotype	IgG
Includes	This ChIPAb+ Acetyl-Histone H4 (Lys12) -ChIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.
Antigen	Acetyl-Histone H4 (Lys12)α
Regulatory Status	RUO
Gene Symbols	HIST1H4A, H4/J, HIST1H4F, HIST1H4L, H4FN, H4FA, H4FH, HIST1H4H, H4F2, H4FM, H4/A, H4FK, H4FG, HIST2H4, H4FB, H4/K, HIST1H4I, H4/N, HIST1H4B, H4FE, H4/M, H4/a, HIST1H4E, HIST4H4, HIST2H4A, H4FC, H4FI, H4/H, HIST1H4C, H4/G, HIST1H4K, H4FJ, H4FD, H4/I, H4/B, H4/D, H4/C, HIST1H4J, HIST1H4D, H4/E
Purification Method	Protein A purified
Gene ID (Entrez)	NM_003538.3
Formulation	Anti-Acetyl-Histone H4 (Lys12) (rabbit monoclonal), . One vial containing 50μL of rabbit monoclonal IgG cell culture supernatant in 0.1% sodium azide. Negative Control Supernatant, . One vial containing 100μL of cultured supernatant in 0.05% sodium azide. ChIP Primers, human GAPDH coding region. One vial containing 75μL of 5μM each primer specific for human GAPDH coding region. FOR: GGC TCC CAC CTT TCT CAT CC; REV: GGC CAT CCA CAG TCT TCT GG
Immunogen	Peptide corresponding to Histone H4 containing the sequence [GLG-AcK-GGA] on which Lys12 is acetylated.
Classification	Monoclonal
Primary or Secondary	Primary
Test Specificity	This antibody detects histone H4 acetylated at Lys12.

202

MilliporeSigma™ Upstate™ Histone H3.3, Rabbbit Polyclonal, ChIP Validated Antibody and Primer Set

Rabbit Polyclonal Antibody

Pricing & Availability
Specifications

Content And Storage	-20°C for up to 12 months from date of receipt; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles
Host Species	Rabbit
Applications	ChIP Assay,Dot Blot,Western Blot
Gene Accession No.	P84243
Includes	This ChIPAb+ Histone H3.3 -ChIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.
Antigen	Histone H3.3
Regulatory Status	RUO
Gene Symbols	H3F3A, H3.3A, H3F3, PP781, H3F3B, H3.3B
Purification Method	Affinity Purified
Gene ID (Entrez)	NP_002098
Formulation	Anti-Histone H3.3 (rabbit polyclonal). One vial containing 50μg of purified rabbit polyclonal in buffer containing 0.1M Tris-Glycine (pH 7.4), 150mM NaCl with 0.05% sodium azide before the addition of glycerol to 30%. Concentration: 0.7mg/mL. Normal Rabbit IgG. One vial containing 125μg of Rabbit IgG in 125μL of storage buffer containing 0.05% sodium azide. Control Primers, GAPDH Coding Region D2 Human. One vial containing 75μL of 5μM of each primer specific for human GAPDH coding region. FOR: GCC ATG TAG ACC CCT TGA AGA G; REV: ACT GGT TGA GCA CAG GGT ACT TTA T
Immunogen	KLH-conjugated linear peptide corresponding to human Histone H3.3.
Classification	Polyclonal
Primary or Secondary	Primary
Test Specificity	This antibody recognizes human Histone H3.

203

MilliporeSigma™ Upstate™ N-CoR, Rabbbit Polyclonal, ChIP Validated Antibody and Primer Set

Rabbit Polyclonal Antibody

Pricing & Availability
Specifications

Content And Storage	-20°C for up to 12 months from date of receipt; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles
Host Species	Rabbit
Applications	ChIP Assay,Western Blot
Gene Accession No.	Q60974.
Includes	This ChIPAb+ N-CoR -ChIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.
Antigen	N-CoR
Regulatory Status	RUO
Gene Symbols	Ncor1, Rxrip13
Purification Method	Affinity Purified
Gene ID (Entrez)	NP_035438
Formulation	Anti-N-CoR (Rabbit Polyclonal). One vial containing 75μg of affinity purified polyclonal in buffer containing 0.1M Tris-glycine (pH 7.4) and 150mM NaCl with 0.05% sodium azide before the addition of 30% glycerol. Concentration: 0.7mg/mL. Normal Rabbit IgG One vial containing 125μg of Rabbit IgG in 125μL of storage buffer containing 0.05% sodium azide. ChIP Primers, p21. One vial containing 75μL of each primer (5μM) specific for the human p21 (WAF1/CIP1/CDKN1A) promoter. FOR: CCC ACA GCA GAG GAG AAA GAA; REV: CTG GAA ATC TCT GCC CAG ACA
Immunogen	KLH-conjugated linear peptide corresponding to a region between amino acids 1510 and 1540 of the N-CoR protein.
Classification	Polyclonal
Primary or Secondary	Primary

204

MilliporeSigma™ Upstate™ FOXA1, Rabbbit Polyclonal, ChIP Validated Antibody and Primer Set

Rabbit Polyclonal Antibody

Pricing & Availability
Specifications

Content And Storage	-20°C for up to 12 months from date of receipt; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles
Host Species	Rabbit
Applications	ChIP Assay,Immunocytochemistry,Western Blot
Gene Accession No.	P55317
Includes	This ChIPAb+ FOXA1 -ChIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.
Antigen	FOXA1
Regulatory Status	RUO
Gene Symbols	FOXA1, HNF-3-alpha, HNF-3A, HNF3A, TCF3A, MGC33105
Purification Method	Affinity Purified
Gene ID (Entrez)	NP_004487
Formulation	Anti-FOXA1 (Rabbit Polyclonal). One vial containing 50μL of purified rabbit polyclonal in buffer containing 0.1 M Tris-Glycine (pH 7.4, 150mM NaCl) with 0.05% sodium azide before the addition of glycerol to 30%. Concentration: 0.35mg/mL. Normal Rabbit IgG. One vial containing 125μg Rabbit IgG in 125μL storage buffer containing 0.05% sodium azide. ChIP Primers, Mouse Hnf4α enhancer. One vial containing 75μL of 5μM of each primer specific for Mouse Hnf4α enhancer. FOR: TTC CAG CTG CCT TTA TCT CCC TGT; REV: TCT CCA CAC ATG TCC AGC AGC CT
Immunogen	Recombinant protein corresponding to the entire protein of human FOXA1
Classification	Polyclonal
Primary or Secondary	Primary
Test Specificity	This antibody recognizes HNF-3A/FOXA1.

205

MilliporeSigma™ Upstate™ JMJD6, Rabbbit Polyclonal, ChIP Validated Antibody and Primer Set

Rabbit Polyclonal Antibody

Pricing & Availability
Specifications

Content And Storage	-20°C for up to 12 months from date of receipt; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles
Host Species	Rabbit
Applications	ChIP Assay,Western Blot
Gene Accession No.	Q6NYC1
Includes	This ChIPAb+ JMJD6 -ChIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.
Antigen	JMJD6
Regulatory Status	RUO
Gene Symbols	JMJD6, PTDSR1, PTDSR, PSR
Purification Method	Affinity Purified
Gene ID (Entrez)	NP_001074930
Formulation	Anti-JMJD6 (rabbit polyclonal). One vial containing 50μL of purified rabbit polyclonal in buffer containing 0.1M Tris-Glycine (pH 7.4), 150mM NaCl and 0.05% sodium azide before the addition of glycerol to 30%. Concentration: 0.7mg/mL. Normal Rabbit IgG. One vial containing 125μg of Rabbit IgG in 125μL of storage buffer containing 0.05% sodium azide. ChIP Primers, human β-globin. One vial containing 75μL of each primer (5μM) specific for the human β-globin promoter. FOR: AGG ACA GGT ACG GCT GTC ATC; REV: TTT ATG CCC AGC CCT GGC TC
Immunogen	Linear peptide corresponding to human JMJD6.
Classification	Polyclonal
Primary or Secondary	Primary
Test Specificity	This antibody recognizes JMJD6.

206

MilliporeSigma™ Upstate™ FOXA2α, Mouse monoclonal, ChIP Validated Antibody and Primer Set

Mouse Monoclonal Antibody

Pricing & Availability
Specifications

Content And Storage	-20°C for one year from date of shipment; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles
Host Species	Mouse
Applications	ChIP Assay,Immunocytochemistry,Western Blot
Form	Purified
Gene Accession No.	Q9Y261
Isotype	IgG1 κ
Includes	This ChIPAb+ FOXA2 -ChIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.
Antigen	FOXA2α
Regulatory Status	RUO
Gene Symbols	FOXA2, HNF3B, TCF3B
Purification Method	Protein G
Gene ID (Entrez)	NP_068556
Formulation	Anti-FOXA2 (mouse monoclonal),. One vial containing 100μL of purified mouse monoclonal IgG1κ in buffer containing 0.1M Tris-Glycine (pH 7.4) and 150mM NaCl with 0.05% sodium azide before the addition of glycerol to 30%. Concentration: 0.175mg/mL. Normal Mouse IgG. One vial containing 125μg of purified mouse IgG in 125μL of storage buffer containing 0.1% sodium azide. ChIP Primers, Mouse Hnf4α enhancer. One vial containing 75μL of 5μM of each primer specific for Mouse Hnf4α enhancer. FOR: TTC CAG CTG CCT TTA TCT CCC TGT; REV: TCT CCA CAC ATG TCC AGC AGC CT
Immunogen	Recombinant protein corresponding to the human FOXA2.
Classification	Monoclonal
Primary or Secondary	Primary

207

MilliporeSigma™ Upstate™ JMJD1C, Rabbbit Polyclonal, ChIP Validated Antibody and Primer Set

Rabbit Polyclonal Antibody

Pricing & Availability
Specifications

Content And Storage	-20°C for up to 12 months from date of receipt; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles
Host Species	Rabbit
Applications	ChIP Assay,Immunocytochemistry,Western Blot
Gene Accession No.	Q15652
Includes	This ChIPAb+ JMJD1C -ChIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.
Antigen	JMJD1C
Regulatory Status	RUO
Gene Symbols	TRIP8, RP11-10C13.2, JMJD1C, JHDM2C
Purification Method	Affinity Purified
Gene ID (Entrez)	NP_116165
Formulation	Anti-JMJD1C (rabbit polyclonal). One vial containing 50μL of purified rabbit polyclonal in buffer containing 0.1 M Tris-Glycine (pH 7.4), 150mM NaCl and 0.05% sodium azide before the addition of glycerol to 30%. Concentration: 0.7mg/mL. Normal Rabbit IgG. One vial containing 125μg of Rabbit IgG in 125μL of storage buffer containing 0.05% sodium azide. ChIP Primers, human β-globin. One vial containing 75μL of each primer (5μM) specific for the human β-globin promoter. FOR: AGG ACA GGT ACG GCT GTC ATC; REV: TTT ATG CCC AGC CCT GGC TC
Immunogen	KLH-conjugated linear peptide corresponding to human JMJD1C.
Classification	Polyclonal
Primary or Secondary	Primary

208

MilliporeSigma™ Upstate™ Trimethyl-Histone H3 (Lys36)α, Rabbit Monoclonal, ChIP Validated Antibody and Primer Set

Rabbit Monoclonal Antibody

Pricing & Availability
Specifications

Content And Storage	-20°C for one year from date of shipment; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles
Host Species	Rabbit
Applications	ChIP Assay,Dot Blot,Functional Assay,Western Blot
Form	Purified
Gene Accession No.	Q16695
Isotype	IgG
Includes	This ChIPAb+ Trimethyl-Histone H3 (Lys36) -ChIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.
Antigen	Trimethyl-Histone H3 (Lys36)α
Regulatory Status	RUO
Gene Symbols	H3.4, H3/g, H3/t, H3FT, H3T, H3t, MGC126886, MGC126888, OTTHUMP00000037945
Purification Method	Protein A purified
Gene ID (Entrez)	NP_003484
Formulation	Anti-Trimethyl-Histone H3 (Lys36) (rabbit monoclonal IgG). One vial containing 50μL of protein A purified IgG in a solution containing 0.07 M Tris-glycine, 0.105 M NaCl, pH 7.4, 0.035% sodium azide and 30% glycerol. Normal Rabbit IgG. One vial containing 125μg Rabbit IgG in 125μL of storage buffer containing 0.05% sodium azide. ChIP Primers, BDNF Intron. One vial containing 75μL of 5μM of each primer specific for human BDNF intron. FOR: ACCCCAACCTCTAACAGCATTA; REV: TGTCTCTCAGCAGTCTTGCATT
Immunogen	KLH-conjugated,synthetic peptide containing the sequence ....GVme3KKP…,in which me3K corresponds to human trimethyl-histone H3 (Lys36).
Classification	Monoclonal
Primary or Secondary	Primary
Test Specificity	Recognizes Trimethyl-Histone H3 (Lys36), Mr ∽17kDa.

209

MilliporeSigma™ Upstate™ Histone H4α, Rabbit Monoclonal, ChIP Validated Antibody and Primer Set

Rabbit Monoclonal Antibody

Pricing & Availability
Specifications

Content And Storage	-20°C for one year from date of shipment; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles
Host Species	Rabbit
Applications	ChIP Assay,Western Blot
Form	Purified
Gene Accession No.	P62805
Includes	This ChIPAb+ Histone H4 -ChIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.
Antigen	Histone H4α
Regulatory Status	RUO
Gene Symbols	HIST1H4A, H4/J, HIST1H4F, HIST1H4L, H4FN, H4FA, H4FH, HIST1H4H, H4F2, H4FM, H4/A, H4FK, H4FG, HIST2H4, H4FB, H4/K, HIST1H4I, H4/N, HIST1H4B, H4FE, H4/M, H4/a, HIST1H4E, HIST4H4, HIST2H4A, H4FC, H4FI, H4/H, HIST1H4C, H4/G, HIST1H4K, H4FJ, H4FD, H4/I, H4/B, H4/D, H4/C, HIST1H4J, HIST1H4D, H4/E
Purification Method	Protein A purified
Gene ID (Entrez)	NP_001029249
Formulation	Anti-Histone H4 (rabbit monoclonal IgG). One vial containing 50μL of protein A purified rabbit monoclonal IgG supernatant in buffer containing 0.1 M Tris-Glycine (pH 7.4), 150mM NaCl with 0.05% sodium azide before addition of glycerol to 40%. Normal Rabbit IgG. One vial containing 75μg of normal rabbit IgG in 75μL storage buffer. ChIP Primers, β-Globin. One vial containing 75μL of 5μM of each primer specific for human β-Globin. FOR: AGG ACA GGT ACG GCT GTC ATC; REV: TTT ATG CCC AGC CCT GGC TC
Immunogen	KLH-conjugated synthetic peptide corres-ponding to amino acids 17-28 of Histone H4.
Classification	Monoclonal
Primary or Secondary	Primary
Test Specificity	Recognizes Histone H4.

210

MilliporeSigma™ Aquaporin 2 (254-271), Rabbbit Polyclonal, ChIP Validated Antibody and Primer Set

Rabbit Polyclonal Antibody

Pricing & Availability
Specifications

Includes	50μL antibody lyophilized from PBS, 5% sucrose, pH 7.4 and 40μg control peptide lyophilized from PBS.
Antigen	Aquaporin 2 (254-271)
Regulatory Status	RUO
Content And Storage	−20°C
Host Species	Rabbit
Applications	Immunohistochemistry,Immunoprecipitation
Form	Purified
Formulation	50μl antibody lyophilized from PBS, 5% sucrose, pH 7.4 and 40μg control peptide lyophilized from PBS.
Immunogen	a synthetic peptide [(KY)RQSVELHSPQSLPRGSKA] corresponding to amino acids 254-271 of rat and mouse AQP2,conjugated to KLH
Classification	Polyclonal
Isotype	IgG
Primary or Secondary	Primary
Test Specificity	Recognizes the ∽40kDa and ∽29kDa forms of aquaporin-2 in rat kidney membrane. Supplied with a control peptide (AQP2_254-271 immunogen peptide).

Antibody Panels and Kits

Filtered Search Results

Narrow Results